Rep15^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rep15^em1(IMPC)Tcp
• Name: RAB15 effector protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755079
• Gene: Rep15 Location: Chr6:146934035-146935016 bp, + strand Genetic Position: Chr6, 77.7 cM, cytoband G3
• Alliance: Rep15^em1(IMPC)Tcp page
• IMPC: Rep15 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0362, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences TCAGCGGATACTCAAACCCG and GGAGAACCTAAGGCTATCAG. This resulted in a 388 bp deletion from Chr6:147032784 to 147033171 in ENSMUSE00000277388. This mutation is predicted to cause a frameshift with amino acid changes after residue 41 and early truncation 2 amino acids later (p.F41Vfs*4). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rep15 Mutation: 12 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)