Rnf144a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf144a^em1(IMPC)Tcp
• Name: ring finger protein 144A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755081
• Gene: Rnf144a Location: Chr12:26356796-26465296 bp, - strand Genetic Position: Chr12, 9.69 cM, cytoband A3
• Alliance: Rnf144a^em1(IMPC)Tcp page
• IMPC: Rnf144a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0404, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATGTCCGTTTGGCAGAATAG, ATTAAGATAGAACGCATACC, TTGCACCTCTGGGATAATGT, and GCCTGGGTATGTGATCTATT. This resulted in deletion of 775-bp on Chr12:26327094 to 26327868 deleting exons ENSMUSE00000107366 and ENSMUSE00000107364 (GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 46 and early truncation 21 amino acids later (p.C46Rfs*23). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnf144a Mutation: 23 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)