Scarb2^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scarb2^em2(IMPC)Tcp
• Name: scavenger receptor class B, member 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5755083
• Gene: Scarb2 Location: Chr5:92589170-92653516 bp, - strand Genetic Position: Chr5, 46.82 cM, cytoband E3
• Alliance: Scarb2^em2(IMPC)Tcp page
• IMPC: Scarb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0266, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AATCCTGAGGAGATCCTCCA and AACTGGATGTACACAGGTAG. This resulted in a 11 bp deletion from Chr5:92485237 to 92485249 encompassing ENSMUSE00000321438. This mutation is predicted to cause a frameshift with amino acid changes after residue 75 and early truncation 3 amino acids later (p.I75Kfs*5). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Scarb2 Mutation: 64 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)