Scarb2^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scarb2^em2(IMPC)Tcp
• Name: scavenger receptor class B, member 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5755083
• Gene: Scarb2 Location: Chr5:92589170-92653516 bp, - strand Genetic Position: Chr5, 46.82 cM, cytoband E3
• Alliance: Scarb2^em2(IMPC)Tcp page
• IMPC: Scarb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0266, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AATCCTGAGGAGATCCTCCA and AACTGGATGTACACAGGTAG. This resulted in a 11 bp deletion from Chr5:92485237 to 92485249 encompassing ENSMUSE00000321438. This mutation is predicted to cause a frameshift with amino acid changes after residue 75 and early truncation 3 amino acids later (p.I75Kfs*5). (GRCm38). (J:165963)

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
hm1	Scarb2^em2(IMPC)Tcp/Scarb2^em2(IMPC)Tcp	C57BL/6NCrl-Scarb2^em2(IMPC)Tcp/Tcp

Phenotypes:

Affected Systems	hm1
show or hide all annotated terms Sex:
Source:	IMPC - TCP	IMPC - TCP
adipose tissue	√	√
decreased total body fat amount	√	√
cardiovascular system	√	√
cardiovascular system phenotype	√	√
abnormal sinus arrhythmia	√
increased heart rate variability	√	√
prolonged RR interval	√	√
abnormal QT variability	√	√
growth/size/body		√
increased lean body mass		√
enlarged kidney		√
hematopoietic system	√	√
decreased mean corpuscular volume	√
thrombocytosis	√
decreased monocyte cell number	√	√
increased leukocyte cell number	√
increased neutrophil cell number	√
increased lymphocyte cell number	√	√
homeostasis/metabolism	√
increased blood urea nitrogen level	√
immune system	√	√
decreased monocyte cell number	√	√
increased leukocyte cell number	√
increased neutrophil cell number	√
increased lymphocyte cell number	√	√
enlarged lymph nodes		√
mortality/aging		√
preweaning lethality, incomplete penetrance		√
renal/urinary system		√
enlarged kidney		√
skeleton	√	√
increased bone mineral content	√	√

View phenotypes and curated references for all genotypes (concatenated display).

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Scarb2 Mutation: 64 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)