Slc23a3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc23a3^em1(IMPC)Tcp
• Name: solute carrier family 23 (nucleobase transporters), member 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755087
• Gene: Slc23a3 Location: Chr1:75102185-75110534 bp, - strand Genetic Position: Chr1, 38.6 cM, cytoband C3
• Alliance: Slc23a3^em1(IMPC)Tcp page
• IMPC: Slc23a3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0311, was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNAs with spacer sequences CAGCGAGACTGAATAAATTA, GTCACGTGGTATGATACCTC, GGACTGTCGGGAGTAATCAA, and GTTTAGATTATCAGGCCCTG. This resulted in a 1154 bp-deletion from Chr1:75131276 to 75132429 in OTTMUSE00000662432 & OTTMUSE00000662425 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc23a3 Mutation: 24 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)