About   Help   FAQ
Thoc6em5(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Thoc6em5(IMPC)Tcp
Name: THO complex 6; endonuclease-mediated mutation 5, The Centre for Phenogenomics
MGI ID: MGI:5755089
Gene: Thoc6  Location: Chr17:23887588-23892856 bp, - strand  Genetic Position: Chr17, 11.97 cM
Alliance: Thoc6em5(IMPC)Tcp page
IMPC: Thoc6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GGTCATGTGCAGTCGCTGCA and GCTGCCAGAAACTTCCCGCA. This resulted in a 17 bp deletion from Chr17:23670837 to 23670853 in OTTMUSE00000307828. This mutation is predicted to cause a frameshift with amino acid changes after residue 34 and early truncation 35 amino acids later (p.P34Gfs*37). (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Thoc6 Mutation:  32 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory