About   Help   FAQ
Meak7em3(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Meak7em3(IMPC)Tcp
Name: MTOR associated protein, eak-7 homolog; endonuclease-mediated mutation 3, The Centre for Phenogenomics
MGI ID: MGI:5755090
Gene: Meak7  Location: Chr8:120486815-120505155 bp, - strand  Genetic Position: Chr8, 68.32 cM, cytoband E1
Alliance: Meak7em3(IMPC)Tcp page
IMPC: Meak7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0321, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GGCCAGTTGGAGCTATGCGA and GAGAAGCACGCGTCCTCCTC. This resulted in a 486 bp deletion from Chr8:119771064 to 119771549 encompassing ENSMUSE00000318051 (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Meak7 Mutation:  24 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory