Tmem160^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem160^em1(IMPC)Tcp
• Name: transmembrane protein 160; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755091
• Gene: Tmem160 Location: Chr7:16186867-16189415 bp, + strand Genetic Position: Chr7, 9.13 cM, cytoband A2
• Alliance: Tmem160^em1(IMPC)Tcp page
• IMPC: Tmem160 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AGTGTCCGAGCTGGATCGCG and ACTTCTGTCATCCGGCATTG. This resulted in a 1,033 bp deletion from Chr7:16453129 to 16454161 and 16 bp deletion from Chr7:16454205 to 16454221, from within exons ENSMUSE00000384664 and ENSMUSE00000198013, removing the splice donor site from the distal exon. This mutation is predicted to cause a frameshift with amino acid changes after residue 57 and early truncation 5 amino acids later (p.R57Wfs*7) (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem160 Mutation: 6 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)