Trh^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trh^em1(IMPC)Tcp
• Name: thyrotropin releasing hormone; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755093
• Gene: Trh Location: Chr6:92219042-92221631 bp, - strand Genetic Position: Chr6, 41.03 cM
• Alliance: Trh^em1(IMPC)Tcp page
• IMPC: Trh gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0430 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TCAAGAATCGACGTTCTGGC, CAGATGCCCCCCAAGTCAAG, GCTTTGATCTTCGTGCTAAC, and GGATCTATGAACCTCCGGCC. This resulted in a 1,034-bp deletion from Chr6:92242806 to 92243839 (GRCm38) in exons ENSMUSE00000194388 and ENSMUSE00000414256, p.(F14*). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trh Mutation: 23 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)