Rmnd5b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rmnd5b^em1(IMPC)J
• Name: required for meiotic nuclear division 5 homolog B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755131
• Synonyms: Rmnd5b^em1J
• Gene: Rmnd5b Location: Chr11:51514500-51526723 bp, - strand Genetic Position: Chr11, 31.15 cM, cytoband B1.3
• Alliance: Rmnd5b^em1(IMPC)J page
• IMPC: Rmnd5b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rmnd5b-7482J-F6151 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTGTCCAGGGTCTAGGAG, CTAGTGTGTACTGGTTTGGC, ACATGTAGTAGGAAGCAGAC, and GTGTTTAACTCTGGCATGCA, which resulted in a 350 bp deletion spanning ENSMUSE00000293981 (exon 3) beginning at Chromosome 11 negative strand position 51,628,161 bp, GTGTTTAACTCTGGCATGCAG and ending after AGTGTGTACTGGTTTGGCAG at 51,627,812 bp (GRCm38/mm10). This mutation deletes exon 3 and 204 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change in amino acid sequence after residue 46 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rmnd5b Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)