Rusc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rusc1^em1(IMPC)J
• Name: RUN and SH3 domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755133
• Synonyms: Rusc1^em1J
• Gene: Rusc1 Location: Chr3:88991288-89000618 bp, - strand Genetic Position: Chr3, 39.01 cM, cytoband F2
• Alliance: Rusc1^em1(IMPC)J page
• IMPC: Rusc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rusc1-7548J-M2497 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAGATTTAATGTAGTGAGG, TGCAAAGCAAGAGGGTCCAG, TAGCTATCCACCCCAAACCC, and CCAAGGCTCATTCAGAAGGC, which resulted in a 261 bp deletion spanning exon 4 of ENSMUSE00000341390 beginning at Chromosome 3 negative strand position 89,089,651 bp, CTTCTGAATGAGCCTTGGTT and ending after GGCTAGCCACGCCTCTGGACC at 89,089,391 bp (GRCm38/mm10). This mutation deletes exon 4 and 184 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 479 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rusc1 Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)