Rai14em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rai14em1(IMPC)J |
Name: |
retinoic acid induced 14; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5755138 |
Synonyms: |
Rai14em1J |
Gene: |
Rai14 Location: Chr15:10569055-10714710 bp, - strand Genetic Position: Chr15, 5.35 cM, cytoband A2
|
Alliance: |
Rai14em1(IMPC)J page
|
IMPC: |
Rai14 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Rai14-7533J-F9911 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGAAGGCCCCCAAAGCAT, ATACTGGCTTGTTAAGGGTG, AACCGCCTTCCACTTCACCG, and CCATCAGCAAACTCCAACAA, which resulted in a 467 bp deletion spanning exon 3 beginning at Chromosome 15 negative strand position 10,633,455 bp, GTTGGAGTTTGCTGATGGCTG, and ending after ATCAAGGGGAGTTTGACCAAT at 10632989 bp (GRCm38/mm10). This mutation deletes exon 3 and 336 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 12 and early truncation 59 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|