Rai14^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rai14^em1(IMPC)J
• Name: retinoic acid induced 14; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755138
• Synonyms: Rai14^em1J
• Gene: Rai14 Location: Chr15:10569055-10714710 bp, - strand Genetic Position: Chr15, 5.35 cM, cytoband A2
• Alliance: Rai14^em1(IMPC)J page
• IMPC: Rai14 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rai14-7533J-F9911 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGAAGGCCCCCAAAGCAT, ATACTGGCTTGTTAAGGGTG, AACCGCCTTCCACTTCACCG, and CCATCAGCAAACTCCAACAA, which resulted in a 467 bp deletion spanning exon 3 beginning at Chromosome 15 negative strand position 10,633,455 bp, GTTGGAGTTTGCTGATGGCTG, and ending after ATCAAGGGGAGTTTGACCAAT at 10632989 bp (GRCm38/mm10). This mutation deletes exon 3 and 336 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 12 and early truncation 59 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rai14 Mutation: 163 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)