Dalrd3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dalrd3^em1(IMPC)J
• Name: DALR anticodon binding domain containing 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755383
• Synonyms: Dalrd3^em1J
• Gene: Dalrd3 Location: Chr9:108447085-108449973 bp, + strand Genetic Position: Chr9, 59.51 cM
• Alliance: Dalrd3^em1(IMPC)J page
• IMPC: Dalrd3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dalrd3-7439J-M5809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGTTCCGTGGATCCCGCT, GTAAGTGGGCCGTAGTTCCG, GAGTCATGATAATCTAAGCC, and GTGCGTGTTCGAAGCTATAA, which resulted in a 413 bp deletion spanning ENSMUSE00000221392 (exon 2) beginning at Chromosome 9 negative strand position 108,570,528 bp, CAGGCTTAGATTATCATGAC, and ending after GTGTAAGTGGGCCGTAGTTC at 108,570,116 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 55 and early truncation 45 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dalrd3 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)