Ccdc30^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc30^em1(IMPC)J
• Name: coiled-coil domain containing 30; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755389
• Synonyms: Ccdc30^em1J
• Gene: Ccdc30 Location: Chr4:119179665-119272718 bp, - strand Genetic Position: Chr4, 55.35 cM, cytoband D1
• Alliance: Ccdc30^em1(IMPC)J page
• IMPC: Ccdc30 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ccdc30-7437J-M5774 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATCTGAGAGGATATGCCAA, AGACTACCATTCCGGCTGTG, GCAAGTATGCTCAGGATACG, and CGTGTCAGAGACACGCACAT, which resulted in a 311 bp deletion, spanning ENSMUSE00000449557 (exon 3) beginning at Chromosome 4 negative strand position 119,401,203 bp, GTATCCTGAGCATACTTGCTGT and ending after TCCCCAAGTCTTCAAGAAAT at 119,400,873 bp (GRCm38/mm10), but with 20 bp of intronic sequence, GTGGGGTGATCTGAGAGGAT, retained. This mutation deletes exon 3 and 160 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change of amino acid sequence after residue 55 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc30 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)