Pdgfrl^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdgfrl^em1(IMPC)J
• Name: platelet-derived growth factor receptor-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755394
• Synonyms: Pdgfrl^em1J
• Gene: Pdgfrl Location: Chr8:41379270-41443819 bp, + strand Genetic Position: Chr8, 23.89 cM
• Alliance: Pdgfrl^em1(IMPC)J page
• IMPC: Pdgfrl gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Pdgfrl-7448J-M4575 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTAAGGAACCCACAGCAGG, ACTTATGATTATGGCTGAAA, GTTAATACCGCATCTCCCAA, and CTTGGCCTAGCACAATAAAC, which resulted in a 395 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 40,938,018 bp, TTGAAGCCACCTGCTGTGGG and ending after GCATCACTGGCTTCCTGTTTA at 40,938,412 bp (GRCm38/mm10). This mutation deletes exon 2 and 97 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 7bp (GTGGCAT) insertion and coincident deletion of 3 base pairs (AAA)in the intron before the deletion, and an additional 12 bp deletion downstream of the 395 bp exon 2 deletion in the intron, that does not affect the deletion of the exon. This mutation is predicted to result in an early truncation after 19 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pdgfrl Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)