About   Help   FAQ
Rfc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rfc2em1(IMPC)J
Name: replication factor C (activator 1) 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755480
Synonyms: Rfc2em1J
Gene: Rfc2  Location: Chr5:134611544-134627182 bp, + strand  Genetic Position: Chr5, 74.68 cM
Alliance: Rfc2em1(IMPC)J page
IMPC: Rfc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rfc2-7423J-F4989 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACCTTGCCAGAATCTGCA, CAACACACAGAGGCTAAGCC, ATTGCTATGTCAACCCCACG, and TCGTGGGGTTGACATAGCAA, which resulted in a 413 bp deletion spanning exon 2 beginning at Chromosome 5 positive strand position 134,586,788 bp, GTGTTGGCATCACAGCTCCACCT, and ending after GGCCTCTATTTTTATTTATTT at 134,587,200 bp (GRCm38/mm10). This mutation deletes exon 2 and 343 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after residue 33 and early truncation 36 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rfc2 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory