Rfc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rfc2^em1(IMPC)J
• Name: replication factor C (activator 1) 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755480
• Synonyms: Rfc2^em1J
• Gene: Rfc2 Location: Chr5:134611544-134627182 bp, + strand Genetic Position: Chr5, 74.68 cM
• Alliance: Rfc2^em1(IMPC)J page
• IMPC: Rfc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rfc2-7423J-F4989 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACCTTGCCAGAATCTGCA, CAACACACAGAGGCTAAGCC, ATTGCTATGTCAACCCCACG, and TCGTGGGGTTGACATAGCAA, which resulted in a 413 bp deletion spanning exon 2 beginning at Chromosome 5 positive strand position 134,586,788 bp, GTGTTGGCATCACAGCTCCACCT, and ending after GGCCTCTATTTTTATTTATTT at 134,587,200 bp (GRCm38/mm10). This mutation deletes exon 2 and 343 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after residue 33 and early truncation 36 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rfc2 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)