Rbpms2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbpms2^em1(IMPC)J
• Name: RNA binding protein with multiple splicing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755482
• Synonyms: Rbpms2^em1J
• Gene: Rbpms2 Location: Chr9:65536930-65567810 bp, + strand Genetic Position: Chr9, 35.43 cM
• Alliance: Rbpms2^em1(IMPC)J page
• IMPC: Rbpms2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rbpms2-7534J-F9923 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTAGAGAGGGCCCCAGA, GCTGTAAGACTTTTCCACAA, ACATATTCAGATCCTGAGAT, and TCTAGGCTGAGCCAGAGGGC, which resulted in a 270 bp deletion spanning exon 6 beginning at Chromosome 9 positive strand position 65,650,854 bp, CAACCTTCTGGGGCCCTCTCT and ending after CCTTCTCCTGCCCTCTGGCT at 65,651,123 bp (GRCm38/mm10). This mutation deletes exon 6 and 119 bp of flanking intronic sequence including the splice acceptor and donor. In addition to the large defined deletion there are two small deletions of 6 bp (CTTTCC) and 19 bp upstream of the 270bp deletion that will not affect the results of the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 69 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rbpms2 Mutation: 205 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)