Dctn6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dctn6^em1(IMPC)J
• Name: dynactin 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755486
• Synonyms: Dctn6^-, Dctn6^em1J
• Gene: Dctn6 Location: Chr8:34557574-34575866 bp, - strand Genetic Position: Chr8, 20.9 cM, cytoband A3
• Alliance: Dctn6^em1(IMPC)J page
• IMPC: Dctn6 gene page

Dctn6^em1(IMPC)J/Dctn6^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as normal blastocysts but not at E7.5. Blastocysts grown in culture fail to hatch from the zona pellucida and to form a typical outgrowth colony.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dctn6-7440J-F5820 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCAAACTGGACGGCACG, CCTGGGCAGCGGCCGATGTT, AGTGCCAGACCTACAGCCGA, and GCTGCACTTCCAGCAGGAGG, which resulted in a 348 bp deletion spanning exon 4 beginning at Chromosome 8 negative strand position 34,097,481 bp, CTGTAGGTCTGGCACTAACT, and ending after GGAAGGTTTCCCAACATCGG at 34,097,134 bp (GRCm38/mm10). This mutation deletes exon 4 and 259 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 65 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dctn6 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)