Rab11fip3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab11fip3^em1(IMPC)J
• Name: RAB11 family interacting protein 3 (class II); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755639
• Synonyms: Rab11fip3^em1J
• Gene: Rab11fip3 Location: Chr17:26208010-26288529 bp, - strand Genetic Position: Chr17, 13.05 cM
• Alliance: Rab11fip3^em1(IMPC)J page
• IMPC: Rab11fip3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab11fip3-7419J-M4978 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGCTGGATGAAAGCACAC, GTGCAGCTCCACAAGCCAGC, CAGTCAGTAGGCAGCTATGG, and AACAAAAATAATAATCTCGA, which resulted in a 362 bp deletion spanning exon 4 beginning at Chromosome 17 negative strand position 26,016,187 bp, GCTGCCTACTGACTGTCCAT, and ending after TGTGGAGCTGCACCTGTGTG at 26,015,826 bp (GRCm38/mm10). This mutation deletes exon 4 and 150 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 594 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab11fip3 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)