Rab6b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab6b^em1(IMPC)J
• Name: RAB6B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755647
• Synonyms: Rab6b^em1J
• Gene: Rab6b Location: Chr9:102988986-103062475 bp, + strand Genetic Position: Chr9, 54.88 cM
• Alliance: Rab6b^em1(IMPC)J page
• IMPC: Rab6b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab6b-7421J-M4508 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAAGACCAGCCTATGGCTA, CTAGCCATAGGCTGGTCTTA, GCTCTCCAGACAGGGTCCAC, and AGGGAGCATTGAGCTCAGAG, which resulted in a 178 bp deletion spanning exon 2 beginning at Chromosome 9 positive strand position 103,140,328bp, CCTAGCCATAGGCTGGTCTT and ending after CTCTGTCTCTGCCTGTGGAC at 103,140,505 bp (GRCm38/mm10). This mutation deletes exon 2 and 119 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 23 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab6b Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)