Rragd^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rragd^em1(IMPC)J
• Name: Ras-related GTP binding D; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755994
• Synonyms: Rragd^em1J
• Gene: Rragd Location: Chr4:32983037-33022180 bp, + strand Genetic Position: Chr4, 14.57 cM
• Alliance: Rragd^em1(IMPC)J page
• IMPC: Rragd gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rragd-7547J-M2556 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCACCTGAACCACCAACCA, AGAAACCCCAGAACAGGAGA, CTCTGATCCCACAGATGCAG, and GGGCACTCCCCTGCATCTGT, which resulted in a 539 bp deletion spanning exon 2 beginning at Chromosome 4 positive strand position 32,995,678 bp, GTTGGTGGTTCAGGTGGCAC, and ending after CTGTTAGAGGGCACTCCCCT at 32996216 bp (GRCm38/mm10). This mutation deletes exon 2 and 243 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change of amino acid sequence after 48 residues and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rragd Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)