Acot2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acot2^em1(IMPC)J
• Name: acyl-CoA thioesterase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763009
• Synonyms: Acot2^em1J
• Gene: Acot2 Location: Chr12:84034635-84040647 bp, + strand Genetic Position: Chr12, 38.99 cM, cytoband D3
• Alliance: Acot2^em1(IMPC)J page
• IMPC: Acot2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Acot2-7575J-M3846 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGGTGCTTGAAGACCGGA, GGAAACTGTGGACTCAGCCC, CGTTGATGAGGAGATCTGAT, TATAGACTGTCTCCCAGACA, which resulted in a 378 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 83,990,413 bp, CTTTATGATCAGTCTGAAAC, and ending after TTGTGGCAGCCCCTCCCTGT at 83,990,790 bp (GRCm38/mm10). This mutation deletes exon 2 and 175 bp of flanking intronic sequence including the splice acceptor and donor. There is also a 4 bp deletion in the 5-prime intron 16 bp before the exon deletion that will not affect the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 193 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Acot2 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)