Ttc32^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttc32^em1(IMPC)J
• Name: tetratricopeptide repeat domain 32; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763010
• Synonyms: Ttc32^em1J
• Gene: Ttc32 Location: Chr12:9079997-9086394 bp, + strand Genetic Position: Chr12, 3.98 cM, cytoband A1.3
• Alliance: Ttc32^em1(IMPC)J page
• IMPC: Ttc32 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ttc32- 7506J-M9214 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACAACACGCTGTGTGGA, AGCCCCACGAAAGTCGCCGA, AGAGCGATCAGCTGTCGTGA and AGGTTTAGAGCTAAGGAACA, which resulted in a 489 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 9,034,742 bp, GTCGCCGATGGTCTTCCACA, and ending after TTTAGAGCTAAGGAACAAGGAA at 9,035,230 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 46 and early truncation after an additional 3 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ttc32 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)