Scgb1c1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scgb1c1^em1(IMPC)J
• Name: secretoglobin, family 1C, member 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763057
• Synonyms: Scgb1c1^em1J
• Gene: Scgb1c1 Location: Chr7:140425478-140426682 bp, + strand Genetic Position: Chr7, 86.04 cM
• Alliance: Scgb1c1^em1(IMPC)J page
• IMPC: Scgb1c1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Scgb1c1-7549J-M2473 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTGGATCCAGTTAGCCCA, CCTTCCCCATCACCACTAGT, GGAAGAACTGCAAACATTCG, and TGCGAGGTCTCCATCTCTGC, which resulted in a 487 bp deletion spanning exon 2 beginning at Chromosome 7 positive strand position 140,845,938 bp, CCCACTAGTGGTGATGGGG, and ending after ACCCCAAAAGAACTACAT at 140846424 bp (GRCm38/mm10). This mutation deletes exon 2 and 287 bp of flanking intronic sequence including the splice acceptor and donor. There is also a small 9 bp deletion (ttagcccag) 64 bp before the 487 bp deletion that will not affect the results of the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 19 and a stop after an additional 47 amino acids. Note the stop is due to read through into the 3-prime untranslated portion of the transcript. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Scgb1c1 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)