Mcmbp^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mcmbp^em1(IMPC)J
• Name: minichromosome maintenance complex binding protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763071
• Synonyms: Mcmbp^em1J
• Gene: Mcmbp Location: Chr7:128298165-128342153 bp, - strand Genetic Position: Chr7, 70.41 cM
• Alliance: Mcmbp^em1(IMPC)J page
• IMPC: Mcmbp gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mcmbp-7557J-M9618 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGCGCTACTTCTAGTCACG, TTCTGTGTTGTGCCTCTAGA, GGACACTCACAGGTATTCAA and TCACCAGGCACCGCAAACCC, which resulted in a 361 bp deletion spanning exon 2 beginning at Chromosome 7 negative strand position 128,725,395 bp, AGGGAGCTAAGGGCAAGCAG, and ending after CCGCCCCACCAGCCACGTGAC at 128,725,035 bp (GRCm38/mm10). This mutation deletes exon 2 and 275 bp of flanking intronic sequence including the splice acceptor and donor. There is also a small 10 bp deletion (gcctctagat) 82 bp after the 361 bp deletion that will not affect the results of the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 19 and an early truncation after an additional 28 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mcmbp Mutation: 83 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)