About   Help   FAQ
Mcmbpem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mcmbpem1(IMPC)J
Name: minichromosome maintenance complex binding protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763071
Synonyms: Mcmbpem1J
Gene: Mcmbp  Location: Chr7:128298165-128342153 bp, - strand  Genetic Position: Chr7, 70.41 cM
Alliance: Mcmbpem1(IMPC)J page
IMPC: Mcmbp gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mcmbp-7557J-M9618 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGCGCTACTTCTAGTCACG, TTCTGTGTTGTGCCTCTAGA, GGACACTCACAGGTATTCAA and TCACCAGGCACCGCAAACCC, which resulted in a 361 bp deletion spanning exon 2 beginning at Chromosome 7 negative strand position 128,725,395 bp, AGGGAGCTAAGGGCAAGCAG, and ending after CCGCCCCACCAGCCACGTGAC at 128,725,035 bp (GRCm38/mm10). This mutation deletes exon 2 and 275 bp of flanking intronic sequence including the splice acceptor and donor. There is also a small 10 bp deletion (gcctctagat) 82 bp after the 361 bp deletion that will not affect the results of the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 19 and an early truncation after an additional 28 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mcmbp Mutation:  83 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory