Adamts14^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adamts14^em1(IMPC)J
• Name: ADAM metallopeptidase with thrombospondin type 1 motif 14; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763135
• Synonyms: Adamts14^em1J
• Gene: Adamts14 Location: Chr10:61032891-61109217 bp, - strand Genetic Position: Chr10, 32.16 cM
• Alliance: Adamts14^em1(IMPC)J page
• IMPC: Adamts14 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Adamts14-7576J-M3885 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAAATCCCAAATCTATAGG, ATGTACAACAGGAGTAAAAG, CTTTACTATGCACTGTGCAG and GATGGGGGGTCATAGGGTGA, which resulted in a 560 bp deletion spanning exon 2 beginning at Chromosome 10 negative strand position 61,271,347 bp, CACCCTATGACCCCCCATCC, and ending after ACCCAGAGCCCCCTATAGATT at 61,270,788 bp (GRCm38/mm10). This mutation deletes exon 2 and 159 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 27 and early truncation 47 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Adamts14 Mutation: 100 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)