Iqca1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Iqca1em1(IMPC)J |
Name: |
IQ motif containing with AAA domain 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763150 |
Synonyms: |
Iqcaem1J |
Gene: |
Iqca1 Location: Chr1:89969854-90081123 bp, - strand Genetic Position: Chr1, 45.08 cM, cytoband C5
|
Alliance: |
Iqca1em1(IMPC)J page
|
IMPC: |
Iqca1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Iqca-7545J-F2516 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAAACCCCACCACCATG, CGAAGAAGTCTGCAGACAAT, GCACCTTTAACAGAACCCAC and GTGGATAGCATTCATCCATG, which resulted in a 524 bp deletion spanning exon 2 beginning at Chromosome 1 negative strand position 90,145,184 bp, TCATCCATGAGGTTGTCTAA and ending after ACTCAAACCCCACCACCAT at 90,144,661 bp (GRCm38/mm10) with a single base pair insertion, A, in place of this deletion. This mutation deletes exon 2 and 199 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 4 and early truncation 11 amino acids later. In addition, there is a 4 bp (gtgg) deletion 39 bp before the 524 bp deletion that is not predicted to impact the outcome of this mutation.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|