About   Help   FAQ
Iqca1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Iqca1em1(IMPC)J
Name: IQ motif containing with AAA domain 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763150
Synonyms: Iqcaem1J
Gene: Iqca1  Location: Chr1:89969854-90081123 bp, - strand  Genetic Position: Chr1, 45.08 cM, cytoband C5
Alliance: Iqca1em1(IMPC)J page
IMPC: Iqca1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Iqca-7545J-F2516 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAAACCCCACCACCATG, CGAAGAAGTCTGCAGACAAT, GCACCTTTAACAGAACCCAC and GTGGATAGCATTCATCCATG, which resulted in a 524 bp deletion spanning exon 2 beginning at Chromosome 1 negative strand position 90,145,184 bp, TCATCCATGAGGTTGTCTAA and ending after ACTCAAACCCCACCACCAT at 90,144,661 bp (GRCm38/mm10) with a single base pair insertion, A, in place of this deletion. This mutation deletes exon 2 and 199 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 4 and early truncation 11 amino acids later. In addition, there is a 4 bp (gtgg) deletion 39 bp before the 524 bp deletion that is not predicted to impact the outcome of this mutation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Iqca1 Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory