Tmcc3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmcc3^em1(IMPC)J
• Name: transmembrane and coiled coil domains 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763283
• Synonyms: Tmcc3^em1J
• Gene: Tmcc3 Location: Chr10:94147811-94426818 bp, + strand Genetic Position: Chr10, 48.88 cM
• Alliance: Tmcc3^em1(IMPC)J page
• IMPC: Tmcc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tmcc3-7561J-M9674 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACAGGTGTTCCAACGGCG, CCCTGAATCCCAATTCTAGG, CCTGGAAAAATCCTACACCG and TTAGGCAACCGGGTAACAGA, which resulted in a 497 bp deletion spanning exon 3 beginning at Chromosome 10 positive strand position 94,582,088 bp, CCTAGAATTGGGATTCAGGG, and ending after CTGTTGGCTTATGTTCCCTCT at 94,582,584 bp (GRCm38/mm10), with 3 base pairs (CCG) retained in place of this deletion. This mutation deletes exon 3 and 361 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 332 and an early truncation after an additional 27 amino acids. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmcc3 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)