Cnksr2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cnksr2^em1(IMPC)J
• Name: connector enhancer of kinase suppressor of Ras 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763463
• Synonyms: Cnksr2^em1J
• Gene: Cnksr2 Location: ChrX:156604432-156826290 bp, - strand Genetic Position: ChrX, 72.76 cM
• Alliance: Cnksr2^em1(IMPC)J page
• IMPC: Cnksr2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cnksr2-7605J-M4582 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAAGTAACCCCACATACAT, TGTACAAACCGATGTATGTG, TTGTCCCACTGCCATCACAT and GAAAAGCTTTTAATAAATAA, which resulted in a 321 bp deletion spanning exon 3 beginning at Chromosome X negative strand position 157994008 bp, CATAGGATGATGAAAAGCTT, and ending after TAAGTAACCCCACATACATCG at 157993688 bp (GRCm38/mm10). This mutation deletes exon 3 and 118 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 76 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cnksr2 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)