St6galnac3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
St6galnac3em1(IMPC)J |
Name: |
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763623 |
Synonyms: |
St6galnac3em1J |
Gene: |
St6galnac3 Location: Chr3:152903911-153430804 bp, - strand Genetic Position: Chr3, 77.82 cM, cytoband H4
|
Alliance: |
St6galnac3em1(IMPC)J page
|
IMPC: |
St6galnac3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project St6galnac3-7558J-M9635 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACGTCATGAGCCAACACAG, GTTCACTTGACAGCCGGCAG, TTGATTCCTCAAGCACTCAT and GCTACAGGTGTAGCCTTTAT, which resulted in a 708 bp deletion spanning exon 3 beginning at Chromosome 3 negative strand position 153,412,014 bp, GTCCAATAAAGGCTACACCT, and ending after CGTCATGAGCCAACACAGAG at 153,411,307 bp (GRCm38/mm10). This mutation deletes exon 3 and 298 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 31 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|