Adamts16^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adamts16^em1(IMPC)J
• Name: ADAM metallopeptidase with thrombospondin type 1 motif 16; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763624
• Synonyms: Adamts16^em1J
• Gene: Adamts16 Location: Chr13:70875921-70989930 bp, - strand Genetic Position: Chr13, 35.97 cM
• Alliance: Adamts16^em1(IMPC)J page
• IMPC: Adamts16 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Adamts16-7577J-M3910 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGACTTGCAGACCAGCATAG, TTGCTGGCTGCTTACCTGTG, CAGTGCCCGCATTTTCACTG and ACTCTGCTGGTCCTAGCGCC, which resulted in a 271 bp deletion spanning exon 2 beginning at Chromosome 13 negative strand position 70,841,480 bp, GGCGCTAGGACCAGCAGAGT, and ending after AAGCAGCCAGCAACCCCCTA at 70,841,210 bp (GRCm38/mm10). This mutation deletes exon 2 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Adamts16 Mutation: 84 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)