Tomm22^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tomm22^em1(IMPC)J
• Name: translocase of outer mitochondrial membrane 22; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763625
• Synonyms: Tomm22^em1J
• Gene: Tomm22 Location: Chr15:79555069-79557063 bp, + strand Genetic Position: Chr15, 37.85 cM
• Alliance: Tomm22^em1(IMPC)J page
• IMPC: Tomm22 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tomm22-7567J-M3164 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGGCCCTTCCGTGCCGCG, CGTGGACGCCGCGAGCCGAG, GTGGTTGGTCTTCTGCAGAA and CGGGTGCTGTCAAAGGACAG, which resulted in a 345 bp deletion spanning exon 2 beginning at Chromosome 15 positive strand position 79,671,092 bp, GCACGGAAGGGCCAGGCCCG, and ending after GAGTGTGGTTGGTCTTCTGC at 79,671,436 bp (GRCm38/mm10). This mutation deletes exon 2 and 225 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tomm22 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)