About   Help   FAQ
Tomm22em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tomm22em1(IMPC)J
Name: translocase of outer mitochondrial membrane 22; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763625
Synonyms: Tomm22em1J
Gene: Tomm22  Location: Chr15:79555069-79557063 bp, + strand  Genetic Position: Chr15, 37.85 cM
Alliance: Tomm22em1(IMPC)J page
IMPC: Tomm22 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tomm22-7567J-M3164 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGGCCCTTCCGTGCCGCG, CGTGGACGCCGCGAGCCGAG, GTGGTTGGTCTTCTGCAGAA and CGGGTGCTGTCAAAGGACAG, which resulted in a 345 bp deletion spanning exon 2 beginning at Chromosome 15 positive strand position 79,671,092 bp, GCACGGAAGGGCCAGGCCCG, and ending after GAGTGTGGTTGGTCTTCTGC at 79,671,436 bp (GRCm38/mm10). This mutation deletes exon 2 and 225 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tomm22 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory