About   Help   FAQ
Wscd2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wscd2em1(IMPC)J
Name: WSC domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763626
Synonyms: Wscd2em1J
Gene: Wscd2  Location: Chr5:113638199-113727786 bp, + strand  Genetic Position: Chr5, 55.55 cM
Alliance: Wscd2em1(IMPC)J page
IMPC: Wscd2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Wscd2-7568J-M3187 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGGGCAGTAGGAACTAG, GTTTCCATCTCTTGAATATC, GGACATGTCTGGGGATATGG and GTTCGCCTTGGCTTGTCAGA, which resulted in a 388 bp deletion spanning exon 3 (ENSMUSE00000478656) beginning at Chromosome 5 positive strand position 113,558,183 bp, AGTTCCTACTGCCCATATTGG and ending after TTCGCCTTGGCTTGTCAGAG at 113,558,570 bp (GRCm38/mm10) with 3 base pairs (AAT) left in place of this deletion. This mutation deletes exon 3 and 270 bp of flanking intronic sequence, including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 133 and a early truncation an additional 24 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wscd2 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory