About   Help   FAQ
Col16a1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Col16a1em1(IMPC)J
Name: collagen, type XVI, alpha 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763667
Synonyms: Col16a1em1J
Gene: Col16a1  Location: Chr4:129941638-129993070 bp, + strand  Genetic Position: Chr4, 63.43 cM
Alliance: Col16a1em1(IMPC)J page
IMPC: Col16a1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Col16a1-7606J-F4542 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGCATTAGGAACTCAGGA, AGAATTCCCGGAGCTCTGCT, AGGTCACTATGAACTCTGGG and TCTACCTATTGTCCACCACT, which resulted in a 437 bp deletion spanning exons 3 and 4 beginning at Chromosome 4 positive strand position 130051616 bp, CTCCTGAGTTCCTAATGCTC, and ending after ACTCTACCTATTGTCCACCA, at 130052052 bp (GRCm38/mm10). This mutation deletes exons 3 and 4 and 244 bp of flanking intronic and intron 3-4 sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 15 amino acids later. In addition, there is a 5 bp (ctctg) deletion 13 bp before the 437 bp deletion that is not predicted to impact the outcome of this mutation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Col16a1 Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory