About   Help   FAQ
Crebzfem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Crebzfem1(IMPC)J
Name: CREB/ATF bZIP transcription factor; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763778
Synonyms: Crebzfem1J
Gene: Crebzf  Location: Chr7:90091937-90097202 bp, + strand  Genetic Position: Chr7, 50.59 cM
Alliance: Crebzfem1(IMPC)J page
IMPC: Crebzf gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Crebzf-7607J-M4528 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAGCGCTGCATCTCGG, GGTGCCAGTCCGGTTGCCGA, GCCGCGTCGTCCTCTTCCCG and GGTGTCGGTGGAGTTCTGCT, which resulted in a 679 bp deletion in exon 1 beginning at Chromosome 7 positive strand position 90443370 bp, CTCGGCAACCGGACTGGCAC, and ending after AAGGTGTCGGTGGAGTTCTG at 90444048 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 120 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Crebzf Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory