Fam110d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam110d^em1(IMPC)J
• Name: family with sequence similarity 110, member D; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763786
• Synonyms: Grrp1^em1J
• Gene: Fam110d Location: Chr4:133978421-133981417 bp, - strand Genetic Position: Chr4, 66.5 cM
• Alliance: Fam110d^em1(IMPC)J page
• IMPC: Fam110d gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Grrp1-7625J-M2529 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCACCACCGACACCGTG, GCGGCGACGTTGCGACCTGA, TCACCCACTACACCTTCGAG and TATCTTTTACCGCCAGAAGA, which resulted in a 698 bp deletion in exon 2 beginning at Chromosome 4 negative strand position 134,252,135 bp, AGGGGACGAACCCCCAGCGCC, and ending after GCGGGACGGACGCCCCACGGT at 134,251,438 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 10 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fam110d Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)