Clstn2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clstn2^em1(IMPC)J
• Name: calsyntenin 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5766210
• Synonyms: Clstn2^em1J
• Gene: Clstn2 Location: Chr9:97326448-97915234 bp, - strand Genetic Position: Chr9, 51.06 cM, cytoband E4
• Alliance: Clstn2^em1(IMPC)J page
• IMPC: Clstn2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Clstn2-7604J-M4612 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACGGTGTGCTTGGAAGG, CCTGTCGCCCACCTTCTCCC, TTGTAGATCCAGCTCTGTCG and TCACCATGCTCAACTAGACT, which resulted in a 445 bp deletion spanning exon 3 beginning at Chromosome 9 negative strand position 97,583,831 bp, GTCTAGTTGAGCATGGTGAAT, and ending after CACCAACGGTGTGCTTGGAA at 97,583,387 bp (GRCm38/mm10). This mutation deletes exon 3 and 249 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Clstn2 Mutation: 55 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)