About   Help   FAQ
Frmpd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Frmpd1em1(IMPC)J
Name: FERM and PDZ domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5766262
Synonyms: Frmpd1em1J
Gene: Frmpd1  Location: Chr4:45184875-45285936 bp, + strand  Genetic Position: Chr4, 23.77 cM
Alliance: Frmpd1em1(IMPC)J page
IMPC: Frmpd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Frmpd1-7623J-M1181 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTCAGCCCAAGGATAACAG, ATACACAGAATTTCAAAAGG, GCCCAGCTACTCTCCCTAAG and TGCCTTTTTTACAGGTCAGG, which resulted in a 301 bp deletion spanning exon 3 beginning at Chromosome 4 positive strand position 45243539 bp, CTTTCCTCTGTTATCCTTGGG, and ending after TAGCCTCTTAGGGAGAGTAG at 45243839 bp (GRCm38/mm10). This mutation deletes exon 3 and 143 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Frmpd1 Mutation:  63 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory