Sdf2l1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sdf2l1^em1(IMPC)J
• Name: stromal cell-derived factor 2-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5766773
• Gene: Sdf2l1 Location: Chr16:16948002-16950247 bp, - strand Genetic Position: Chr16, 10.62 cM
• Alliance: Sdf2l1^em1(IMPC)J page
• IMPC: Sdf2l1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Sdf2l1-7484J-F6196 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCCGTTCCGAAACCCACAG, GGCAGGGACCCAAAGACAGA, GTGATTAACAAGAATCCACG and CTTTTTAGTGTTCAAGACGA, which resulted in a 60 bp deletion beginning at Chromosome 16 negative strand position 17,131,827 bp, AATCCACGGGGTGGGGTGGG, and ending after GCCAACAGTCGGTAACCGGC at 17,131,768 bp (GRCm38/mm10). This mutation deletes 26 bp of ENSMUSE00000130280 (exon 2) and 34 bp of intronic sequence immediately preceding the exon and removes the splice acceptor, in addition there is a 9 bp (ccactaaat) insertion at this site, as well as a 3 bp deletion in the intron 29 bp before the 60 bp deletion. Finally there is a 61 bp deletion 162 bp after the 60 bp deletion, which deletes the last 9 bp of the exon and will not alter the results of the mutation. This mutation is predicted to cause the loss of exon 2 and to result in a change of amino acid sequence after residue 63 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sdf2l1 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)