About   Help   FAQ
Med10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Med10em1(IMPC)J
Name: mediator complex subunit 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5766989
Synonyms: Med10em1J
Gene: Med10  Location: Chr13:69950514-69964223 bp, + strand  Genetic Position: Chr13, 35.55 cM
Alliance: Med10em1(IMPC)J page
IMPC: Med10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Med10-7684J-M3179 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCTGGACCAGGTCCTGTGA, CTCAAGCGTGTAAGCACACC, TGATGTCTGCACACGGACAA and GCTGAGTACTGCTACACTGT, which resulted in a 330 bp deletion spanning exon 3 beginning at Chromosome 13 positive strand position 69,813,580 bp, ACCCGGCTCCTGGACCAGGT, and ending after GGACTGCTGAGTACTGCTAC at 69,813,909 bp (GRCm38/mm10). This mutation deletes exon 3 and 227 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Med10 Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory