Lamp5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lamp5^em1(IMPC)J
• Name: lysosomal-associated membrane protein family, member 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5766991
• Synonyms: Lamp5^em1J
• Gene: Lamp5 Location: Chr2:135894159-135911837 bp, + strand Genetic Position: Chr2, 67.26 cM, cytoband G1
• Alliance: Lamp5^em1(IMPC)J page
• IMPC: Lamp5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Lamp5-7679J-M9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCAGGTGTCCTAAAGCAGA, GGAGCACACTGCTTCGAGCA, CTAGGGGCGGCAGGGCCGAA and ATTCGGGAACAGCCTGCGGG, which resulted in a 405 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 136,058,830 bp, CTGCTTCGAGCAGGGAACTT, and ending after CTTCCCCCCCAAACCCCCCG at 136,059,234 bp (GRCm38/mm10). This mutation deletes exon 2 and 232 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lamp5 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)