Lmcd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lmcd1^em1(IMPC)J
• Name: LIM and cysteine-rich domains 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5771567
• Synonyms: Lmcd1^em1J
• Gene: Lmcd1 Location: Chr6:112250747-112307384 bp, + strand Genetic Position: Chr6, 52.14 cM
• Alliance: Lmcd1^em1(IMPC)J page
• IMPC: Lmcd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Lmcd1-7683J-M3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATGCCAAGTCTCCCAG, GCTGCCACTCACTGTTTACT, GACGGTGTAGGATGCATGCT and GAGAGAACCACCCACAGTTT, which resulted in a 276 bp deletion spanning exon 2 beginning at Chromosome 6 positive strand position 112,304,920 bp, CAGTAAACAGTGAGTGGCAG, and ending after CTTGACTGTCCTTTCCAAAA at 112,305,195 bp (GRCm38/mm10). This mutation deletes exon 2 and 187 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a small 12 bp deletion 33 bp after the 276 bp deletion which will not affect the mutation. The 276 bp deletion is predicted to cause a change of amino acid sequence after residue 14 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lmcd1 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)