About   Help   FAQ
Tomm40em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tomm40em1(IMPC)J
Name: translocase of outer mitochondrial membrane 40; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5774456
Synonyms: Tomm40em1J
Gene: Tomm40  Location: Chr7:19435238-19449363 bp, - strand  Genetic Position: Chr7, 9.94 cM
Alliance: Tomm40em1(IMPC)J page
IMPC: Tomm40 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tomm40-7713J-F6824 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGCTGTTGTGACCTCTGGA, CCCCAAGCCTTTAAGAGTGA, TTGTGAAGAGAGCTTGGGAT and GGCCAAGGTTCCTCTAGTGG, which resulted in a 227 bp deletion spanning exon 2 beginning at Chromosome 7 negative strand position 19,714,445 bp, TGGTGGAATTAGTGAGATAA, and ending after ATGCATACAGATCCCCTCAC at 19,714,219 bp (GRCm38/mm10). This mutation deletes exon 2 and 159 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 38 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tomm40 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory