Tomm40^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tomm40^em1(IMPC)J
• Name: translocase of outer mitochondrial membrane 40; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5774456
• Synonyms: Tomm40^em1J
• Gene: Tomm40 Location: Chr7:19435238-19449363 bp, - strand Genetic Position: Chr7, 9.94 cM
• Alliance: Tomm40^em1(IMPC)J page
• IMPC: Tomm40 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tomm40-7713J-F6824 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGCTGTTGTGACCTCTGGA, CCCCAAGCCTTTAAGAGTGA, TTGTGAAGAGAGCTTGGGAT and GGCCAAGGTTCCTCTAGTGG, which resulted in a 227 bp deletion spanning exon 2 beginning at Chromosome 7 negative strand position 19,714,445 bp, TGGTGGAATTAGTGAGATAA, and ending after ATGCATACAGATCCCCTCAC at 19,714,219 bp (GRCm38/mm10). This mutation deletes exon 2 and 159 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 38 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tomm40 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)