Rab22a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab22a^em1(IMPC)J
• Name: RAB22A, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5774461
• Synonyms: Rab22a^em1J
• Gene: Rab22a Location: Chr2:173501638-173543975 bp, + strand Genetic Position: Chr2, 97.26 cM
• Alliance: Rab22a^em1(IMPC)J page
• IMPC: Rab22a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab22a-7696J-M6742 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGGCTACAAAGTAGTCTT, TACTTTGTAGCCTAAAGTGG, CGTGGAAAGTCATCGCAAGC and TTCATCAAGTTCAGGACAAC, which resulted in a 218 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 173,661,355 bp, CTTTAGGCTACAAAGTAGTC, and ending after GTTCGTGGAAAGTCATCGCA at 173,661,572 bp (GRCm38/mm10). This mutation deletes exon 2 and 138 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab22a Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)