Zfp560^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp560^em1(IMPC)J
• Name: zinc finger protein 560; endonuclease-mediated mutation Jackson
• MGI ID: MGI:5774464
• Synonyms: Zfp560^em1J
• Gene: Zfp560 Location: Chr9:20256432-20296473 bp, - strand Genetic Position: Chr9, 7.52 cM
• Alliance: Zfp560^em1(IMPC)J page
• IMPC: Zfp560 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp560-7726J-F3047 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGAACCATGTCAGCCGAA, TTACATCCATTCGGCTGACA, ATTCCCATATAGTCCAACAT and CATGGATGTCACTCTATCCT, which resulted in a 229 bp deletion spanning exon 3 beginning at Chromosome 9 negative strand position 20,352,939 bp, TATGTTGGACTATATGGGAA, and ending after TGTTACATCCATTCGGCTGA at 20,352,711 bp (GRCm38/mm10). This mutation deletes exon 3 and 140 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp560 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)