Zfp692^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp692^em1(IMPC)J
• Name: zinc finger protein 692; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775599
• Synonyms: Zfp692^em1J, Zfp692^em1((MPC)J
• Gene: Zfp692 Location: Chr11:58197895-58205453 bp, + strand Genetic Position: Chr11, 36.19 cM
• Alliance: Zfp692^em1(IMPC)J page
• IMPC: Zfp692 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp692-7728J-F4807 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGAATGGGAGGTCTGTA, TCCGCACTCACACACTTACA, GTCCTCTTCCCGAACCCAGT and TAAAAGACGTTAACAGGTAG, which resulted in a 190 bp deletion spanning exon 3 beginning at Chromosome 11 positive strand position 58307896 bp, GTTGGCCCTGTAAGTGTGTG, and ending after GGATCAGAAGCTCCTACTGG at 58308085 bp (GRCm38/mm10). This mutation deletes exon 3 and 158 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 35 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp692 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)