About   Help   FAQ
Tcerg1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tcerg1em1(IMPC)J
Name: transcription elongation regulator 1 (CA150); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775646
Synonyms: Tcerg1em1J
Gene: Tcerg1  Location: Chr18:42644552-42708858 bp, + strand  Genetic Position: Chr18, 22.66 cM
Alliance: Tcerg1em1(IMPC)J page
IMPC: Tcerg1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Tcerg1-7710J-M6904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGCTCCAAGGTCACATGG, TATTTTCCCAAGCCTAGAGA, TTAGTATCAATTTTATGCAT and TTATAGAGGTTGCCATTTCT, which resulted in a 343 bp deletion spanning exon 2 beginning at Chromosome 18 positive strand position 42,519,305 bp, CCATGTGACCTTGGAGCTGC, and ending after GTGTTAGTATCAATTTTATG at 42,519,647 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 2 bp deletion 40 bp before the 343 bp deletion and a 6 bp insertion (gtatta) at the 343 bp deletion site, that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 20 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tcerg1 Mutation:  69 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory