Paf1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Paf1^em1(IMPC)J
• Name: Paf1, RNA polymerase II complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775649
• Synonyms: Paf1^em1J
• Gene: Paf1 Location: Chr7:28092376-28098813 bp, + strand Genetic Position: Chr7, 16.73 cM
• Alliance: Paf1^em1(IMPC)J page
• IMPC: Paf1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Paf1-7694J-M6789 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAATGCAAGCGTCCAGCAT, TCCTAGAAGCTAAGCTTCTA, GGCCAGCAAAGGCCAGGCCT and CCATGAGGGATACCCAGGCC, which resulted in a 290 bp deletion and 6 bp insertion (ttgcaa) spanning exon 4 beginning at Chromosome 7 positive strand position 28,395,305 bp, CTGGACGCTTGCATTCAGAG, and ending after AGCAAAGGCCAGGCCTGGGT at 28,395,594 bp (GRCm38/mm10). This mutation deletes exon 4 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Paf1 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)