Wdfy4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdfy4^em1(IMPC)J
• Name: WD repeat and FYVE domain containing 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775775
• Synonyms: Wdfy4^em1J
• Gene: Wdfy4 Location: Chr14:32681504-32907465 bp, - strand Genetic Position: Chr14, 19.44 cM
• Alliance: Wdfy4^em1(IMPC)J page
• IMPC: Wdfy4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Wdyf4-7724J-M9881 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTCTATGAGGAAAGGGGAC, CAGGCCTCGAAGGTGTTCCC, CATGTAGCCTTGAGGTACAT and GTTTTGGGAGCTGCGTGGAT, which resulted in a 249 bp deletion spanning exon 4 beginning at Chromosome 14 negative strand position 33,154,162 bp, CTGCGTGGATAGGATGCATC, and ending after CCTGTCCCCTTTCCTCATAG at 33,153,914 bp (GRCm38/mm10). This mutation deletes exon 4 and 142 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 30 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wdfy4 Mutation: 142 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)