About   Help   FAQ
Sh3d19em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sh3d19em1(IMPC)J
Name: SH3 domain protein D19; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775777
Synonyms: Sh3d19em1J
Gene: Sh3d19  Location: Chr3:85878416-86037833 bp, + strand  Genetic Position: Chr3, 37.83 cM, cytoband F1
Alliance: Sh3d19em1(IMPC)J page
IMPC: Sh3d19 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sh3d19-7698J-M1095 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGGACTAGCCATTGC, CCTGAATGTTTGGGCTCCCT, TCTTAGGCCTAACCACCGCT and AGCAACTGAACACTCGGAAC, which resulted in a 208 bp deletion spanning exon 3 beginning at Chromosome 3 positive strand position 86,098,069 bp, GGAGCCCAAACATTCAGGTC, and ending after CCAGTAAGTGATACCGAGCG at 86,098,276 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a stop after residue 266. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sh3d19 Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory