Irgm2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Irgm2^em1(IMPC)J
• Name: immunity-related GTPase family M member 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775779
• Synonyms: Irgm2^em1J
• Gene: Irgm2 Location: Chr11:58105803-58113609 bp, + strand Genetic Position: Chr11, 36.07 cM
• Alliance: Irgm2^em1(IMPC)J page
• IMPC: Irgm2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Irgm2-7677J-F9554 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACAGGTTGGTTTCTGGG, TTCGTGTCCGATGAGCCTAA, CTTGGTAAAGGGTTTCGACG and CTCCCTGTCATCAAGTACCA, which resulted in a 442 bp deletion in exon 2 beginning at Chromosome 11 positive strand position 58,219,790 bp, CACCCAGAAACCAACCTGTT, and ending after TCAAGTACCACGGCCTCGTC at 58,220,231 bp (GRCm38/mm10). This mutation also has a 3 bp deletion (ggc) 49 bp before the 442 bp deletion. Together these are predicted to cause a change of amino acid sequence from RLI to II beginning at residue 83, due to the 3 bp deletion, followed by a change of amino acid sequence 15 residues later at amino acid 101 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Irgm2 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)